Suggested problems

Construction Services Lahore

May 8, 2020, 3:29 p.m. by alnaafay

Biological Motivation

AL Naafay Construction Company Lahore House Construction Grey Structure Rs 1250-1350/sqft A+ with the material of your choice Architect plans Design Plans Contact us +92- constructioncompanylahore com 300-4192356

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: AL Naafay Construction Company Lahore House Construction Grey Structure Rs 1250-1350/sqft A+ with the material of your choice Architect plans Design Plans Contact us +92- constructioncompanylahore com 300-4192356

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21