Suggested problems

Calgary industrial buildings

May 5, 2020, 10:27 a.m. by Calgary12

Biological Motivation

I recently came across your blog and have been reading along. I thought I would leave my first comment. I don't know what to say except that I have enjoyed reading. Nice blog. I will keep visiting this blog very often.

[Calgary industrial buildings][1]

[Calgary farm buildings][2]

[Abbotsford farm buildings][3]

[Maple ridge farm buildings][4]

[Alberta agricultural buildings][5]

[Vancouver warehouse buildings][6]

[Vancouver commercial buildings][7]

[Vancouver shop buildings][8]

[Abbotsford shop buildings][9]

[Abbotsford agricultural buildings][10]

[Vancouver steel buildings][11]

[Kelowna steel buildings][12]

[Alberta pipelines][13]

[Alberta steel buildings][14]

[Canada steel buildings][15]

[1]: https://zentnersteelbuildings.com/steel-buildings-calgary/ [2]: https://zentnersteelbuildings.com/steel-buildings-calgary/ [3]: https://zentnersteelbuildings.com/ [4]: https://zentnersteelbuildings.com/ [5]: https://zentnersteelbuildings.com/steel-buildings-edmonton/ [6]: https://zentnersteelbuildings.com/steel-buildings-vancouver/ [7]: https://zentnersteelbuildings.com/steel-buildings-vancouver/ [8]: https://zentnersteelbuildings.com/steel-buildings-vancouver/ [9]: https://zentnersteelbuildings.com/ [10]: https://zentnersteelbuildings.com/ [11]: https://zentnersteelbuildings.com/steel-buildings-vancouver/ [12]: https://zentnersteelbuildings.com/steel-buildings-kelowna/ [13]: https://zentnersteelbuildings.com/steel-buildings-edmonton/ [14]: https://zentnersteelbuildings.com/ [15]: https://zentnersteelbuildings.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21