Suggested problems

How to contact with QuickBooks Payroll Support

May 2, 2020, 11:29 a.m. by Anika401

Biological Motivation

Intuit made different versions of products for everyone as per their requirements. QuickBooks self-employed is the best accounting software for individuals and freelancers to manage their accounting. Intuit built Quickbooks Self-Employed to help freelancers or self employees to manage their accounting such as income and expenses. Freelancers can calculate and pay their estimated quarterly expenses by using QuickBooks. [QuickBooks Payroll Support][1]

[1]: https://uberaudit.com/quickbooks-payroll-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21