Suggested problems

Netgear extender setup

April 27, 2020, 9:39 a.m. by David Carter

Biological Motivation

Netgear wifi extenders are known for the performance and signal strength they offer. We all know setting up a Netgear wifi extender is a very simple and easy task. But when the device somehow stops working, it becomes a great hassle for the user. Most of the time, users mistakenly modify the settings and netgear extender setup. [https://mywifiext-net.support/netgear-extender-setup/][1]

...

[1]: https://mywifiext-net.support/netgear-extender-setup/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21