Suggested problems

Dehradun Escorts Service | Call Girls Service In Dehradun

April 20, 2020, 7:32 p.m. by CharmingGirls

Biological Motivation

Hello Myself Supriya and I am best call young ladies operator from [Dehradun Escort Services][1]. Welcome to the site which offer any kinds of escort benefits by Beautiful, Lovely, Hot and Sexy Women, Sexy College Girls, VIP Serial Actress, Hot Independent Housewife, VIP T.V. Entertainer with completely getting a charge out of at sensible cost in Dehradun.

We give [Dehradun Escort Services][2] in various territories likes Mapusa City, Panaji City, Miramar Road, Baga-Beach, Calangute-Beach and some more. On the off chance that your chose call young lady will be taking to the firm location during a period that suits you our pressing saving office is likewise accessible, so in the event that you have an exceptional second in your psyche and, at that point don’t interruption to call us.

Here you can get a numerous appealing and striking hot young lady who are mindfully and select by our staff so as to confirmation your wellbeing security and charm and furthermore appropriate chance to locate the English and Hindi talking [Call girls service Dehradun][3]

Our escorts are colossally comprehension of your emotions and delight is ensured with our best assemble young ladies so conference lovely [Dehradun Escorts Service][4] is constantly a good times. We completely had confidence in customer fulfillment with the Dehradun l that our numerous new clients comes through references of our others old clients.

http://www.dehradunescortsgirls.in http://www.dehradunescorts.co.in http://www.dehradunescortsgirls.in/escort-amritsar.html http://www.dehradunescortsgirls.in/escort-ambala.html http://www.dehradunescortsgirls.in/escort-bathinda.html http://www.dehradunescortsgirls.in/escort-bangalore.html http://www.dehradunescortsgirls.in/escort-bareilly.html http://www.dehradunescortsgirls.in/escort-Dehradun.html http://www.dehradunescortsgirls.in/escort-chennai.html http://www.dehradunescortsgirls.in/escort-dharamshala.html http://www.dehradunescortsgirls.in/escort-delhi.html http://www.dehradunescortsgirls.in/escort-dalhousie.html http://www.dehradunescortsgirls.in/escort-mcleodganj.html http://www.dehradunescortsgirls.in/escort-goa.html http://www.dehradunescortsgirls.in/escort-hyderabad.html [1]: http://www.dehradunescortsgirls.in [2]: http://www.dehradunescorts.co.in [3]: http://www.dehradunescortsgirls.in [4]: http://www.dehradunescorts.co.in

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21