Suggested problems

mp7524857@gmail.com

April 7, 2020, 12:07 p.m. by ktalyst

Biological Motivation

cosmetic surgical procedure in the world. But now the industry has grown more and the technology namely Motiva breast implants, the 6th generation of breast implant technology, comes forward in terms of more safety and innovation. Having breast augmentation surgery is a lifetime commitment, hence finding the right place that puts your safety above anything is crucial is difficult. For this reason, there should be use of best and quality devices that have the capability to implant the breast with full safety along with shape. At K-Talyst, safety through innovation is the motto and we are committed to providing complete safety of the process of [Breast augmentation Singapore][1] by distributing the best medical devices.

[1]: https://www.k-talyst.com.sg/motiva-latest-generation-implants-singapore/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21