Suggested problems

QuickBooks Support Line

April 1, 2020, 5:23 a.m. by Anika401

Biological Motivation

QuickBooks is the most reliable, secure and good accounting software that manages accounting tasks of your business, according to research and analysis. However, there is many accounting software available in the market. But QuickBooks is one of the most leading software because its working performance is unique and beneficial to business purposes. And, You can simply contact the [QuickBooks Support][1] Contact page to get QuickBooks help for your problems.

...

[1]: https://www.hawkbuzz.com/quickbooks-customer-service/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21