Suggested problems

How to contact wth QuickBooks Support

March 31, 2020, 5:27 a.m. by Anika401

Biological Motivation

When any company or organization uses QuickBooks Enterprise Support Business Tool or any other software product. They will require some kind of assistance regarding the product in the future. Therefore, to handle this kind of situation, they will look for support. QuickBooks Edition of the business accounting software offers many types of accounting features, like: Maintaining data of your income and expenses, Calculating taxes, and Paying salaries to your employees. For more information contact [QuickBooks Support][1] Customer Service.

...

[1]: https://uberaudit.com/quickbooks-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21