Suggested problems

Which is the best treatment for staphylococcus?

March 29, 2020, 10:32 a.m. by gyansingh4007

Biological Motivation

Prevention and Treatment of staphylococcal infections

Yes, it is possible to prevent [staphylococcal][1] infection, it can be prevented by doing the following: Hand wash daily with soap and water Applying a protective ointment or cream on wounds * Cover the wound with a bandage To know more????[Treatment for staphylococcus aureus][2]

[1]: https://educationbygyan.blogspot.com/2020/02/treatment-for-staphylococcus-aureus.html?m=1 [2]: https://educationbygyan.blogspot.com/2020/02/treatment-for-staphylococcus-aureus.html?m=1

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21