Suggested problems

QuickBooks Support Line

March 19, 2020, 4:33 a.m. by khushijindal

Biological Motivation

Now- a- days I have learned, users suffer from various QuickBooks issues. As you know, all the issues and errors need to be resolve because it affects your productivity. So simple, Just dial our helpline number for quick help and support by our professionals. Users can reach us by calling our [QuickBooks Support Line][1] +1-818-850-7805. For more information, go through our website.

[1]: https://thetechroots.com/quickbooks/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21