Suggested problems

Decentralized Finance (DeFi) Services and Solutions

Feb. 28, 2020, 10:03 a.m. by henrywalter

Biological Motivation

Developcoins - A pre-eminent Blockchain Development Company, our experience in the blockchain industry that helps us to develop a smart contract for all types of DeFi based projects. We also provide a complete DeFi Development Services and Solutions that help the start-ups, businesses to make a profit on their DeFi based projects successfully.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21