Suggested problems

QuickBooks POS Support Phone Number +1-833-401-0204

Feb. 25, 2020, 7:32 a.m. by colqb

Biological Motivation

Avail premium support for the Premier edition of QuickBooks @ QuickBooks Premier Support Phone Number +1-833-401-0204 any time as we are operating 24/7 to serve you. At this number, you will get instant support and an ideal solution for your problem from our ProAdvisor’s. They are highly experienced and dedicated people. Call QuickBooks POS Support Phone Number +1-833-401-0204 any time and get your POS runs smoothly. At this number, you will get certified and trusted support from the finest ProAdvisor’s working around the clock to provide you seamless support. Read more: https://www.probfix.com/quickbooks-pos-support-phone-number/ or https://www.probfix.com/quickbooks-premier-support-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21