Suggested problems

orbi setup

Feb. 25, 2020, 6:51 a.m. by orbi setup

Biological Motivation

[Orbi setup][1] support and phone number. Check how to setup Orbi. Call technical support phone number at +1-844-456-4180 .

...

[1]: https://www.netgearr.support/orbi-setup/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21