Suggested problems

QuickBooks Tech Support Phone Number +1 800-549-0162

Feb. 24, 2020, 9:22 a.m. by Getmyassist

Biological Motivation

If you are facing a problem while working with QuickBooks then call QuickBooks Tech Support Phone Number +1 800-549-0162 instantly to get its required solution. Moreover, the support staff we have are well-qualified, having years of experience in fixing issues related to QuickBooks. Hence, the best thing to do is to call at QuickBooks Support Phone Number +1 800-549-0162. Read more: https://www.getmyassist.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21