Suggested problems

QuickBooks Support Phone Number | +1-833-401-0204 | 24/7 Help

Feb. 24, 2020, 7:42 a.m. by colqb

Biological Motivation

QuickBooks Support Phone Number +1-833-401-0204 is available for you to resolve all your errors instantly. Support is available 24/7. Being a popular accounting software, QuickBooks is not free from technical flaws. Therefore, we have designed a wall-trained team of professionals and highly attentive customer care executives. Our services can be availed remotely through remote desktop access. Our support team can provide services under highly secured servers and diagnose the problem in a few minutes. Read more: https://www.probfix.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21