Suggested problems

QuickBooks Enterprise Support Phone Number +1-833-4O1-O2O4

Feb. 24, 2020, 7:14 a.m. by colqb

Biological Motivation

Nice post, Ring us at our QuickBooks Enterprise Support Phone Number +1-833-4O1-O2O4 and get uninterrupted technical assistance for QuickBooks Enterprise software. Read more: https://www.probfix.com/quickbooks-enterprise-support-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21