Suggested problems

How do you activate nbc channel ?

Feb. 22, 2020, 12:27 p.m. by Aria Smith

Biological Motivation

We can assist you with NBC trigger procedure, so if you're using this wonderful entertainment program and would

like to understand how to trigger it, then all you want to do is, get in contact with all our NBC activation and

service centre. You simply have to call us in our toll-free amount for exact aid. We offer assistance and support NBC program, so in case you've installed the program in your own streaming

apparatus, which appears to be Roku media streaming player, then you need to go NBC Id activate connection and

pick'Roku' as your own streaming apparatus followed by entering the activation code. For any issue, visit :https://www.nbccomactivatetv.com/ ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21