Suggested problems

UFC Live Results

Feb. 21, 2020, 9:56 a.m. by sachielish8860

Biological Motivation

On this page, you'll see a listing of events. Everything is listed by date and time. Scroll down the page and choose what you would like to ascertain and click on on the Watch Now button. a replacement page opens on your browser with a screen. Simply click the play icon within the middle of the screen, then wait a second or two for the video to load. After a minute a conversation also will open and you'll talk with other MMA lovers or you can close the chat at any time. The screen is often maximized within the bottom right corner. Whatever device you watch on, regardless of the size of the screen or wherever you're, we promise you excellent HD quality whenever. And remember, you'll click on the menu icon on the highest right of the page and choose a category for more great live HD sports streams.

Want to Watch [UFC Live Results][1] at home or work? you can watch VIP league streams about all kinds of devices, phones, tablets, and your computer. There’s no sign-up and it’s all free.

Fight fans are spoiled for choice when it comes to looking at the last word Fighting Championships via the net. From paid, legal strategies to slightly less wholesome choices, there's always a way to UFC Live Results and none will price you an arm and a leg if anything.

[1]: https://myufclive.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21