Suggested problems

Garmin Express

Feb. 18, 2020, 6:45 a.m. by Robert jonnes

Biological Motivation

If you have a vehicle and you don’t have any idea of your route and destination. You can install Garmin Express because The includes many features include [Garmin Express][1] like lifetime free traffic alert mode, attached USB cable and connect to another device with BlueTooth, preloaded city navigator, FM traffic receiver with vehicle power cable and more exciting features are included Garmin express device.

[1]: https://www.garminnuviupdates.com/garmin-express-app-download

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21