Suggested problems

Hire iPhone App Developer

Feb. 17, 2020, 1:09 p.m. by TechGropse Pvt. Ltd.

Biological Motivation

Searching to [hire iPhone App Developer][1]? This list will make you easy to hire iOS app developer for your next idea.

[1]: https://www.techgropse.com/blog/hire-iphone-app-developer/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21