Suggested problems

Watch NBA Live Free

Feb. 15, 2020, 10:40 a.m. by Free NBA Live Streaming

Biological Motivation

What makes Andre Iguodala somewhat of a trump card on this rundown is that he can be such an eminent sourpuss. Not many in the group better comprehend what makes for winning b-ball. However on the off chance that Iguodala isn't in the correct storage space or even in the correct state of mind, his cantankerousness could mess more up than it could possibly do for the Warriors. We know how mind blowing Iguodala was for Golden State—in play, however mentally and profoundly.

Be that as it may, will he be a similar sort of impact in Memphis when no game truly matters? Or then again for a mid-level season finisher group where certain colleagues are pulling their own particular manner? Iguodala can be a high-sway player in the most troublesome games and arrangement on the board. Being referred to is whether he truly needs to walk through the remainder of them, particularly for a group with less certain possibilities than the dynastic Warriors. Andre Iguodala will playing his next match againts the Atlanta Hawks Roster. Definetly falcons' solid group. Will Andre assault on the Hawks. Try not to leave these activity match of NBA games. Visit our webpage [Watch NBA Live Free][1] for observe all the live matches of NBA games on your own stuff with your web association. You can likewise get most recent updates on NBA games each day and consistently.

[1]: https://mylivenba.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21