Suggested problems

Unable to install AOL desktop gold for windows

Feb. 15, 2020, 8:11 a.m. by James Tyler

Biological Motivation

To install desktop gold on your system, read this brief guide which includes basic and simple steps that you can try before going for advanced troubleshooting.

  1. Search the downloaded location of AOL Gold file on your device
  2. When you find it, click over it.
  3. Next, you need to click the ‘Install’ icon
  4. Then press the ‘Run’ button.
  5. It will open the installation process box.
  6. Submit ‘Install now’ command
  7. This will start the installation process. Just select ‘Ok’ and then ‘yes’ With these simple and easy steps, you can easily install AOL desktop Gold on your Pc. If you find any trouble during [Install AOL desktop gold for windows 7][1] then you can contact at toll- free number 18555008462 for advanced solution.

[1]: https://desktop-app.com/install-desktop-gold

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21