Suggested problems

Our housewife escorts ladies are ambitious

Feb. 14, 2020, 10:03 a.m. by payal

A Rapid Introduction to Molecular Biology

Our housewife escorts ladies are ambitious and delightful so that they don’t consider in orthodox lifestyle. for the reason that housewife escorts in Bangalore are unhappy with their private existence in order that they need pleasure of their lifestyles https://www.anitabatra.com/services/bangalore-sexual-services.html

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21