Suggested problems

clients from special commercial enterprise enterprise

Feb. 14, 2020, 9:55 a.m. by payal

Biological Motivation

clients from special commercial enterprise enterprise are trying to find private moments with incomparable and mouthwatering beauty babe after you meet her, you'll really sense top of the city. https://www.anitabatra.com/hsr-layout-bangalore-escorts.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21