Suggested problems

all of the fashions in our escort enterprise come from high

Feb. 14, 2020, 9:54 a.m. by payal

Biological Motivation

all of the fashions in our escort enterprise come from high society background and they only entertain elite magnificence customers. Their smooth-spoken competencies, gentle behavior and killing smile make them the finest independent version escorts in Bangalore who have been the favored preference of the VIP clients within the town. https://www.anitabatra.com/services.html

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21