Suggested problems

Now you could make your dream into the fact because

Feb. 14, 2020, 9:53 a.m. by payal

Biological Motivation

Now you could make your dream into the fact because here's a risk to meet with our beautiful and ambitious Bangalore version Escorts girls to your most advantageous amusement. https://www.anitabatra.com/

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21