Suggested problems

you could have an tremendous experience

Feb. 14, 2020, 9:53 a.m. by payal

Biological Motivation

you could have an tremendous experience with our treasured escort version in Bangalore right round all day, every day. they're noticeably clean and sufficiently enthusiastic to offer you the satisfactory revel in that could make clean to understand your excursion to Bangalore. https://www.payalpandya.com/indiranagar-escorts.html

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21