Suggested problems

a extraordinary platform to complete their erotic

Feb. 14, 2020, 9:52 a.m. by payal

Biological Motivation

a extraordinary platform to complete their erotic appetite. in case you arrive in Bangalore and are trying to find mature housewife call ladies escorts for leisure then your seek stops here at Pinki Mishra impartial name girls in Bangalore as we have the distinctive class of the seductive ladies in our premise. https://www.payalpandya.com/about.html

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21