Suggested problems

we have significant style of sensual beauties

Feb. 14, 2020, 9:49 a.m. by payal

Biological Motivation

we have significant style of sensual beauties for our high profile clients which includes scorching version name ladies, naughty university girls escorts, extremely desperate residence other halves, glamorous actresses and independent call women in Bangalore . https://www.payalpandya.com/rates.html

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21