Suggested problems

xfinity.com/authorize

Feb. 12, 2020, 8:15 a.m. by Aria Smith

Biological Motivation

Xfinity or Xfinity Stream is a streaming service that offers live broadcast stations, DVR records, linear cable stations and on-demand videos. You are able to watch live TV stations from almost 200+ favorite networks. It's also possible to download on-demand videos for offline access. In the following guide, we'll illustrate how to set up and activate the Xfinity Stream program on Roku devices. Presently, Xfinity is available in a beta version for Roku platforms, also it does not incorporate the whole set of functionality and features contained in the very first versions.For activating Xfinity Channel visit : https://www.xfinitycomauthorize.com/

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21