Suggested problems

www.trendmicro.com/bestbuyPC

Feb. 6, 2020, 6:44 a.m. by safe-activate

Biological Motivation

Installing Trend Micro Security on your PC([**www.trendmicro.com/bestbuyPC**][1]) Trend Micro Maximum Security uses advanced artificial intelligence technology to provide robust, multi-device protection.It is compatible with various devices like PC, Mac, Smartphones, windows, and laptop. With its ultimate features trend micro download and install process is secure that protects your devices and internet from ransom, malware, spyware, virus, and other threats. Examine buying Trend micro from Trend Micro if you are going to buy a new device for your home, official or commercial use. Trend micro geek squad is a 100% security provider antivirus that removes all types of threats from your devices as well as from the network. Trend Micro Security examines your PC to ensure it meets the fundamental framework necessities; checks it for existing infections or programming you have to uninstall first, and after that returns to hold your hand through the permit survey and establishment process. In case you're introducing the 30-day Trial execution you won't require a sequential number. On the off chance that you've paid for the security, you will be demonstrated where to enter the sequential number. On the off chance that you as of now have a more seasoned release of Trend Micro Security programming introduced on your PC, the installer causes you to uninstall it, prompts you to reboot, and the establishment consequently continues. At the point when the establishment is finished, you've aided the actuation procedure, snared with your Trend Micro record (on the off chance that you as of now have one), or aided through the production of another record in the event that you don't. When initiation is finished, you can physically refresh your infection insurance for the most recent segments or simply let Trend Micro Security update itself for you.

...

[1]: http://www.trendmi-cro.com/bestbuyPC

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21