Suggested problems

printer customer care number

Feb. 4, 2020, 7:56 p.m. by marrymartin

Biological Motivation

We support the ultimate service for all these annoying or notorious issues. If you have some other problem that is not listed in the above list, chat with us directly or contact HP Customer Service phone number in the comfort zone. You will be helped in a cost-effective manner and with satisfaction. The support team not only solve the software issue but also resolve all your hardware issue but in order to resolve the issue you need to visit our website http://webslivesupport.com/printer-customer-support/ Read more:- [Hp printer customer care number][1] ...

[1]: http://webslivesupport.com/printer-customer-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21