Suggested problems

how to connect with QuickBooks Support Experts

Feb. 3, 2020, 10:55 a.m. by rs772244

Biological Motivation

QuickBooks is an accounting tool developed by Intuit Inc. QuickBooks releases many versions like- Payroll, POS, Premier, Online and many more. With the help of this software, users can track income, expenses, and manage their pays. Many users report that they face errors while using QuickBooks. If you are a user of QuickBooks and face any kind of technical and functional error then contact QuickBooks experts on our [QuickBooks Support][1] Helpline number. Our experts are always (24*7) available to provide the best solution to solve any issue related to QuickBooks.

[1]: https://www.cloudnetworkusa.com/quickbooks-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21