Suggested problems

Heritage Jaipur Tour Package

Feb. 3, 2020, 9:46 a.m. by elizagracee

Biological Motivation

Jaipur a sea palace of windows which has the attracting architecture of the various monuments and heritage sights which is famous across the country as the places in Jaipur is indeed the most unique of its kind. Jaipur Tour Package is not merely restricted to the best cafes in town or the biggest malls, but it is a complete round trip to history, devotion, and the sight of love, world’s most beautiful architectures and what not. Heritage Jaipur Tour Package of the pink city is famous for the major tourist centre in the country as the city is full of gratifying forts, world’s best theatres, beautiful markets and many more.

Jaipur Tour Package does not only stuck by seeing forts and the monuments like other cities as the Jaipur serenity has a mixture of all the remarkable things that the tourist have a dream to explore! Jaipur has a lot to give tourists from pageants and festivals to extraordinarily dressed individuals, a wealth of crafts, a royal palace heritage, and sightseeing that will take up their time.

HAWA MAHAL The Heritage of Jaipur

Built by Maharaja Sawai Pratap Singh in 1799, is the most significant monument of Jaipur. The five famous ravishing semi-octagonal monuments having 152 windows with overhanging frame balconies is a piece of Rajput architecture. It is designed basically for the royal ladies to watch out for the processions and the activities holding outside on the street.

CITY PALACE AND S.M.S. II MUSEUM

It is situated in the old Jaipur city as it occupies about one-seventh of the old city area. Palace is a mixture of Rajput and Mughal architecture it houses a Seven-Storeyed Chandra Mahal in the centre, which gives a beautiful view of the gardens and the city. Diwan-E-Aam (Hall of public audience) has intricate decorations and collection of manuscripts, Diwan-E-Khas (Hall of private audience) has a marble pawed gallery Mubarak Mahal has a rich collection of costumes and textiles.

JAIGARH FORT

Standing on a top of a hill looking over the palaces and city of Amer. World’s most significant canon on wheels – the Jai Ban is positioned here, built during the reign of Maharaja Sawai Jai Singh. Has a twenty feet long barrel and pumped in the cannon for a single shot.

NAHARGARH FORT

Top on a hill about 600 ft. above the city, the fort was built in 1734. The walls of the fort run along the ridge and within are architectural beauties like Hawa Mandir.

AMER FORT

It is the principal attraction of Rajasthan Travel Package which is situated 11kms from Jaipur. The fort is divided into six beautifully constructed parts. The main entry is through Suraj Pol or Sun Gate which takes you to the first central courtyard of the fort. The first courtyard, also known as JalebiChowk leads you to the main palace grounds. A small temple is stationed at the right side of the JalebiChowk, which is known as Sila Devi temple which was installed due to many reasons varying from mythological references and royal King’s victories.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21