Suggested problems

Quickbooks Support

Feb. 3, 2020, 9:46 a.m. by Harf farmar

Biological Motivation

QuickBooks is the best financial accounting software for small businessmen. Some time many QuickBooks users face QuickBooks error if you don’t fix you problem contact on our [QuickBooks Support][1] Phone Number they Fix your all types of error on Quickbooks With our QuickBooks Tech Support Service. Our experts have designed the services in an efficient way so that they can provide the necessary solutions to the customers. All you need to do is call the QuickBooks Online Support phone number available on our website. QuickBook has extended its excessive support to entrepreneurs in cost reduction; otherwise, we have already seen how an accountant holds different accounting record files.

[1]: https://throttleinfo.com/quickbooks-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21