Suggested problems

positioned a few effort into ensuring the environment

Jan. 30, 2020, 6:36 a.m. by payal pandya

Biological Motivation

if you’re at domestic [escorts in bangalore][1] or a inn, positioned a few effort into ensuring the environment is easy and inviting. upload a few non-public touches, or lay out a touch surprise in your [Bangalore Escorts][2] earlier than she arrives. https://www.payalpandya.com/links.html

...

[1]: https://www.payalpandya.com/links.html [2]: https://www.payalpandya.com/links.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21