Suggested problems

One night time stand is an ordinary term that characterizes

Jan. 30, 2020, 6:31 a.m. by payal pandya

Biological Motivation

... One night time stand is an ordinary term that characterizes the present day dating where individuals really need animalistic joy. They don’t trouble even to recognise the person points of interest for their accomplices. https://www.payalpandya.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21