Suggested problems

One night time stand is an ordinary term that characterizes

Jan. 30, 2020, 6:29 a.m. by payal pandya

Biological Motivation

One night time stand is an ordinary term [bangalore escorts][1] that characterizes the present day dating where individuals really need animalistic joy. They don’t trouble even to recognise the person points of interest for their accomplices. [https://www.payalpandya.com/][2]

...

[1]: https://www.payalpandya.com/ [2]: https://www.payalpandya.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21