Suggested problems

Is QuickBooks Error Support really effective?

Jan. 28, 2020, 3:05 p.m. by Alena Yadis

Biological Motivation

Facing errors is common while using QuickBooks on a daily basis. I encounter almost one or two errors every other day. Dealing with them is another risk as lack of technical insights would likely create more problems out of it, instead of solving them in the first place. To my rescue, [QuickBooks Error Support][1] provides 24*7 assistance for each and every issue that may come as a halt to my productive day. You can find different support numbers as per the errors in the blog here. However, if you require any immediate assistance over an issue, call us on 855-526-5749 and get expert support.

[1]: https://qbdataservicesupport.com/quickbooks-error-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21