Suggested problems

NBA TV Live Stream

Jan. 23, 2020, 7:36 a.m. by NBA TV Live Stream

Biological Motivation

After months of speculation about his return date, Williamson finally took the floor Wednesday night against the Spurs. The No. 1 overall pick struggled early, but he exploded for 17 straight points in the fourth quarter, finishing with 22 total in the Pelicans' 121-117 loss at the Smoothie King Center. He did a lot of his damage from the outside, hitting all four of his 3-point attempts.

Williamson, the No. 1 pick in last year's NBA draft, has missed all of the 2019-20 NBA season up until now as he recovered from knee surgery in October. That changes within the an hour, as Williamson will take the court with the New Orleans Pelicans in their game tonight against the San Antonio Spurs. Fans! you"ll be able to see free [NBA TV Live Stream][1] your on mobile phones, connected devices, gaming consoles, tablets and web browsers.

[1]: https://mylivenba.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21