Suggested problems

Free Robux

Jan. 20, 2020, 5:52 a.m. by Free Robux Generators

Biological Motivation

[how to get free robux?][1] This is the main question in the minds of game lovers to get the new characters and accessories and characters generated from the currency generated from the free robux generator used in the game.

[1]: https://freerobuxgenerator.us/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21