Suggested problems

UFC Live Stream

Jan. 15, 2020, 9:11 a.m. by MMA Live Stream

Biological Motivation

If you are interested in watching the matches with real action then you should watch UFC Live Stream. It is a new sport which is a mixture of different fighting styles. UFC has gained a lot of popularity all around the world in that short period of time. If you want to Watch [UFC Live Stream][1] then you have visited the right place. As you will be getting the chance to watch UFC Live Stream Free.

Watching Online Sports is now very easy you just have to need a PC with a well Internet Connection so that you can watch live streaming online of this match. If you want to watch live streaming just follow the site. Don’t be upset if you aren’t still tuned with the channels, just click our link and we will provide you 100% quality software to Watch all the matches from anywhere of the world. Get the best online sports coverage on the net directly on your PC. So dear ufc lovers Don’t miss this sports today and Don’t miss to get your link this site.

With unlimited bandwith you can stream your favourite match of all sports with fastest and no lag. It perfectly recomended for UFC Live Stream sports, with fastest server you can enjoy live streaming sports without lag, down, and limited bandwith. We give you the best for watch live streaming all sports. Thanks for watching....

[1]: https://myufclive.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21