Suggested problems

garmin express

Jan. 8, 2020, 11:52 a.m. by jordan john

Biological Motivation

[Garmin Express][1] is a holistic management tool that supports users of cutting-edge Garmin GPS Device. This ingenious desktop application gives a one-stop hassle-free solution for maintaining Garmin gadgets in perfect health. It facilitates users to set up, register, manage and update all of their Garmin devices.

[1]: http://www.garminexpress.support

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21