Suggested problems

Unable to Download AOL Gold Desktop On Windows?

Jan. 8, 2020, 7:03 a.m. by Lisa Scott

Biological Motivation

If you are unable to download desktop gold on Windows then don't bother get to know why you encounter on download issue:

  • Unstable internet connection is reason behind download issue.
  • If your system is infected by Virus and Anti-Malware programs.
  • Junk files or temporary files on your system is also reason.
  • Incompatibility issue.

However, if you find any issue related above then contact experts and take assistance. Latest version of software, follow this [AOL desktop gold download][1]

[1]: https://desktop-software.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21