Suggested problems

The most reliable computer help number

Jan. 4, 2020, 11:09 a.m. by Albert Luca

Biological Motivation

If you are sitting idle because of computer not working, please dial 1-877-916-7666 irrespective of your location around the country. We provide high quality [computer customer help][1] to resolve the issues of our customers.

[1]: https://www.assistanceforall.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21