Suggested problems

Delhi escorts provide hot model services

Jan. 3, 2020, 1:05 p.m. by Kia Sharma

Biological Motivation

As you all know that our Delhi Escorts provide the best services in very affordable price as per the requirements of the customers Wildlife SOS There are many more places, these places are a tourist place tourist has come and enjoy these beautiful moments of our life. Take it. Here you are the model girl. Independent girl. Beautiful girl too. We will give you a good service as you want, you will not have any problem from our side.

Link :- http://www.kiaescorts.com/delhi-escorts

delhi escorts # escorts service in delhi # escorts in delhi # call girls in delhi # new delhi escorts

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21