Suggested problems

Jaipur Escort provide teenager girls for fun

Jan. 3, 2020, 1:03 p.m. by Kia Sharma

Biological Motivation

Jaipur city is a very beautiful city, here people from abroad come missing who take advantage of our agency Kia escorts in which Jaipur escorts are considered very good, here all kinds of sexy call girls are available which attract you very much. . And you can enjoy your physical pleasure with girls of your choice, we provide better services in our escorts and the information is maintained by Gopini!

For more information visit our website….

Link: - http://www.kiaescorts.com/jaipur-escorts

localcallgirls #callgirlsinJaipur #localescorts #sexserviceinJaipur #hotgirlsinJaipur #girlsforsexinJaipur #Jaipurescort #Jaipursexygirls

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21