Suggested problems

Activate espn using espn.com/activate

Dec. 31, 2019, 7:28 a.m. by Liza apic

Biological Motivation

ESPN is one of the most sought after and popular nicely has understood moderate to watch sports programs that you prefer to walk through. One can consult with the Activation manual for additional details, to activate the ESPN channels, and visit https://www.espnactivate.us/ for activation.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21