Suggested problems

How to access best Malwarebytes phone number

Dec. 23, 2019, 11:52 a.m. by Albert Luca

Biological Motivation

Is your Malwarebytes giving you trouble lately? Do you feel [Malwarebytes malware protection off][1] at times? Do not worry as we provide full Malwarebytes support free of cost.

[1]: https://www.assistanceforall.com/services/antivirus-support/malware-bytes-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21