Suggested problems

Problem Solved: Showtime Anytime Com Activate

Dec. 21, 2019, 5 p.m. by Anita felan

Biological Motivation

Problem Solved: Showtime Anytime Com Activate It is a very easy setup to activate showtime anytime on your roku device using this simple steps. Step1 On your roku device then

press the home key on your roku remote and then you may see streaming channels on the screen search showtime anytime and click on

activate enter your details and then enter the activation code. For more instant help visit

http://www.comactivateroku.com/2017/06/29/showtimeanytime-com-activate-roku-help/ or call our toll free number 1-800-717-2062 http://www.comactivateroku.com/2017/06/29/showtimeanytime-com-activate-roku-help/">visit here ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21